Sequence ID | >WENV170012746 |
Genome ID | ASRO01000005 |
Phylum/Class | [ASRO] bioreactor metagenome; day 119 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 77804 |
End posion on genome | 77728 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
atcattcaat |
tRNA gene sequence |
GCGTCTGTGGCTCAACTGGATAGAGCACTGGGTTTCGGCCCCGGGGGTTGAGGGTTCGAA |
Downstream region at tRNA end position |
ttaagaagct |
Secondary structure (Cloverleaf model) | >WENV170012746 Arg TCG t ACCA ttaagaagct G + T C - G G - C T + G C - G T - A G - C T A T C T T C C A C A A G | | + | | G T C T C G G A G G G C G | | | | T T G G A G C A T A A GGGTT C - G T + G G - C G - C G - C T C T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |