Sequence ID | >WENV170012768 |
Genome ID | ASRO01000359 |
Phylum/Class | [ASRO] bioreactor metagenome; day 119 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 4618 |
End posion on genome | 4533 |
Amino Acid | Leu |
Anticodon | AAG |
Upstream region at tRNA start position |
aatttattaT |
tRNA gene sequence |
GCAGTTGTGGCGGAATTGGTATACGCGCAAGACTAAGGATCTTGTGGGCTTAGGCCCGTG |
Downstream region at tRNA end position |
ttgtcgtatc |
Secondary structure (Cloverleaf model) | >WENV170012768 Leu AAG T ATta ttgtcgtatc G - C C - G A - T G - C T - A T - A G - C T G T C C C C C A T A A G | | | | | G T G G C G G G G G G C G | | | T T G A C G C T A T G TGGGCTTAGGCCCGT C - G A - T A - T G - C A - T C A T G A A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |