Sequence ID | >WENV170012773 |
Genome ID | ASRO01000488 |
Phylum/Class | [ASRO] bioreactor metagenome; day 119 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 4652 |
End posion on genome | 4568 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
aactaaatat |
tRNA gene sequence |
GCGGGTGTGGCGGAATTGGCAGACGCACTAGACTTAGGATCTAGCGCTTTACGGCGTGGG |
Downstream region at tRNA end position |
taagagtctc |
Secondary structure (Cloverleaf model) | >WENV170012773 Leu TAG t ACTA taagagtctc G - C C - G G - C G - C G - C T - A G - C T C T T T C C C A T A A G + + | | | G T G G C G G G G G G C G | | | T T G A C G C C A G A CGCTTTACGGCGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |