Sequence ID | >WENV170012781 |
Genome ID | ASRO01000988 |
Phylum/Class | [ASRO] bioreactor metagenome; day 119 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 2046 |
End posion on genome | 2122 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aatttcatat |
tRNA gene sequence |
CGCGGAGTGGAGCAGTCTGGAAGCTCGTCGGGCTCATAACCCGAAGGTCAGAGGTTCAAA |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170012781 Met CAT t ACTA nnnnnnnnnn C A G - C C - G G - C G - C A - T G - C T A T T C T C C A T G A G | | | | | A C C G A G A G A G G C T | | | | T T G G C T C G A A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |