Sequence ID | >WENV170012782 |
Genome ID | ASRO01001106 |
Phylum/Class | [ASRO] bioreactor metagenome; day 119 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1847 |
End posion on genome | 1772 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
gccatattat |
tRNA gene sequence |
GCGGAAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGTCGCGAGTTCGAGT |
Downstream region at tRNA end position |
atttggcgta |
Secondary structure (Cloverleaf model) | >WENV170012782 Gly GCC t TCCA atttggcgta G - C C - G G - C G - C A - T A - T A - T T G T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A A GGGTC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |