Sequence ID | >WENV170012799 |
Genome ID | ASRO01003043 |
Phylum/Class | [ASRO] bioreactor metagenome; day 119 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 316 |
End posion on genome | 243 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
caaatgcaat |
tRNA gene sequence |
GCGGGTATAGTTTAGTGGTAGAACCTCAGCCTTCCAAGCTGATGATGCGGGTTCGATTCC |
Downstream region at tRNA end position |
attgcttttg |
Secondary structure (Cloverleaf model) | >WENV170012799 Gly TCC t TCCA attgcttttg G - C C - G G - C G - C G - C T - A A - T T T T C G C C C A G A A | | | | | G T T T T G G C G G G C G + | | | T T G G A A C T A C TGAT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |