Sequence ID | >WENV170012804 |
Genome ID | ASRO01003713 |
Phylum/Class | [ASRO] bioreactor metagenome; day 119 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 648 |
End posion on genome | 574 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GGGTCGTTAGCTCAGTGGTAGAGCAGTTGGCTTTTAACCAATTGGTCGTAGGTTCGAATC |
Downstream region at tRNA end position |
acttctctct |
Secondary structure (Cloverleaf model) | >WENV170012804 Lys TTT n ACCA acttctctct G - C G - C G - C T - A C - G G - C T - A T A T C A C C C A G A A | | | | G T C T C G G T A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |