Sequence ID | >WENV170012816 |
Genome ID | ASRO01005503 |
Phylum/Class | [ASRO] bioreactor metagenome; day 119 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 193 |
End posion on genome | 269 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tttaaatctg |
tRNA gene sequence |
GTGGGTATAGCTCAGTTGGTTAGAGCGCTAGATTGTGGCTCTAGAGGCCGTGGGTTCGAA |
Downstream region at tRNA end position |
agtcataaaa |
Secondary structure (Cloverleaf model) | >WENV170012816 His GTG g CCTA agtcataaaa G - C T - A G - C G + T G - C T - A A - T T A T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T T A G AGGCC C - G T - A A - T G - C A - T T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |