Sequence ID | >WENV170012826 |
Genome ID | ASRP01000089 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 9914 |
End posion on genome | 9990 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ataaaaaatc |
tRNA gene sequence |
GGGTCATTAGCTCAGCTGGTTAGAGCACTCGGCTCATAACCGAGTGGTCGAAGGTTCGAG |
Downstream region at tRNA end position |
ctttaaagta |
Secondary structure (Cloverleaf model) | >WENV170012826 Met CAT c ACCA ctttaaagta G - C G - C G - C T - A C - G A - T T - A T G T C T T C C A C G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C T T A A TGGTC C - G T - A C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |