Sequence ID | >WENV170012830 |
Genome ID | ASRP01000265 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 74 |
End posion on genome | 150 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ctcaatatat |
tRNA gene sequence |
GTACCTATAGCTCAATTGGATAGAGCATCTGGCTACGAACCAGAAGGTTAGAGGTTCGAC |
Downstream region at tRNA end position |
taaaataatt |
Secondary structure (Cloverleaf model) | >WENV170012830 Arg ACG t ACCA taaaataatt G - C T - A A - T C - G C - G T - A A - T T C T T C T C C A T A A A | | | | | G T C T C G A G A G G C G | | | | T T G G A G C A T A A AGGTT T - A C - G T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |