Sequence ID | >WENV170012839 |
Genome ID | ASRP01000741 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 166 |
End posion on genome | 240 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
agcattatat |
tRNA gene sequence |
GCCTGTGTAGCTCAGGGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCGTAAGTTCAAGTC |
Downstream region at tRNA end position |
gaagcagtgt |
Secondary structure (Cloverleaf model) | >WENV170012839 Thr GGT t TCCA gaagcagtgt G - C C - G C - G T - A G + T T - A G - C T G T T A T T C A G A A + | | | | A G C T C G G T A A G C G | | | | T T G G A G C T A A AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |