Sequence ID | >WENV170012847 |
Genome ID | ASRP01001057 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 4 |
End posion on genome | 87 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
nnnnnnnttt |
tRNA gene sequence |
GCGGGGGTGGCGGAATTGGCAGACGCGCTAGACTTAGGATCTAGTGTCTTTGACGTGGGG |
Downstream region at tRNA end position |
tattaaaatt |
Secondary structure (Cloverleaf model) | >WENV170012847 Leu TAG t ACCA tattaaaatt G - C C - G G - C G - C G + T G - C G - C T G T C C C C C A T A A G | | | | | A T G G C G G G G G G C G | | | T T G A C G C C A G G TGTCTTTGACGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |