Sequence ID | >WENV170012856 |
Genome ID | ASRP01002975 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1314 |
End posion on genome | 1226 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aatttaatgt |
tRNA gene sequence |
AGAGAGCTGCCAGAGTTGGTCGAATGGACCGGTTTTGAAAACCGGCGAGGTTCACGCCTC |
Downstream region at tRNA end position |
ttaacctttt |
Secondary structure (Cloverleaf model) | >WENV170012856 Ser TGA t GCCA ttaacctttt A - T G - C A - T G - C A - T G - C C - G T A T C C C C C A T T G A G | | | | | G G G A C C G G G G G C G | | | T T T A T G G C G A A CGAGGTTCACGCCTCC C - G C - G G - C G - C T - A T A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |