Sequence ID | >WENV170012857 |
Genome ID | ASRP01002975 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1178 |
End posion on genome | 1104 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tgatttcttt |
tRNA gene sequence |
GGAGCCATAGCAAAGTGGCTAATGCATTGGATTGCAAATCCTTGATCCTCGGTTCGACTC |
Downstream region at tRNA end position |
aacccaactg |
Secondary structure (Cloverleaf model) | >WENV170012857 Cys GCA t TCCA aacccaactg G - C G - C A - T G - C C - G C - G A - T T C T G A G C C A T G A A | | | | | G G A A C G C T C G G C G | | | T T C A T G C T A A GATC T T T T G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |