Sequence ID | >WENV170012869 |
Genome ID | ASRP01004020 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 132 |
End posion on genome | 47 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aaaacttcaT |
tRNA gene sequence |
GCCCGAGTGGCGGAATTGGCAGACGCACAGGACTTAAAATCCTGCGATGTAACAATCGTA |
Downstream region at tRNA end position |
cttatttaat |
Secondary structure (Cloverleaf model) | >WENV170012869 Leu TAA T ATaa cttatttaat G - C C - G C - G C - G G - C A - T G - C T C T T G G C C A T A A G | | | | | G T G G C G A C C G G C G | | | T T G A C G C C A G A CGATGTAACAATCGT C - G A - T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |