Sequence ID | >WENV170012874 |
Genome ID | ASRP01005735 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 271 |
End posion on genome | 195 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cgtaaatatg |
tRNA gene sequence |
GTGCCCGTAGTTCAGTTGGTTAGAATGCCAGGTTGTGACTCTGGAGGTCGAGGGTTCGAA |
Downstream region at tRNA end position |
ttttctcaaa |
Secondary structure (Cloverleaf model) | >WENV170012874 His GTG g CCCA ttttctcaaa G - C T - A G - C C - G C - G C - G G - C C A T T T C C C A T G A A + | | | | G T C T T G G A G G G C G | | | + T T G G A A T T T A G AGGTC C - G C - G A - T G - C G + T T C T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |