Sequence ID | >WENV170012878 |
Genome ID | ASRP01007222 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 399 |
End posion on genome | 474 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cacaaataat |
tRNA gene sequence |
TCCCTTTTAGTTCAGTTGGTAGAACGCCGGACTGTTAATCCGTATGTCGCTGGTTCAAGT |
Downstream region at tRNA end position |
tattttaaaa |
Secondary structure (Cloverleaf model) | >WENV170012878 Asn GTT t GCCA tattttaaaa T - A C - G C - G C - G T - A T - A T - A T G T C G A C C A T G A A | | | | | A T C T T G G C T G G C G | | | | T T G G A A C T A G ATGTC C T C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |