Sequence ID | >WENV170012887 |
Genome ID | ASRP01009335 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 132 |
End posion on genome | 207 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gaaacacttg |
tRNA gene sequence |
GTCCCGTTCGTCTAGAGGCCTAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGACT |
Downstream region at tRNA end position |
ttgggtcgtt |
Secondary structure (Cloverleaf model) | >WENV170012887 Glu TTC g ACCA ttgggtcgtt G + T T - A C - G C - G C - G G - C T - A T C T T C C C C A A G A C | | | | | G G T C T G A G G G G C G + | | | T T C G G A C C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |