Sequence ID | >WENV170012888 |
Genome ID | ASRP01009335 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 210 |
End posion on genome | 285 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ggataccatt |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGTAGAGCAGTTGACTTTTAATCAATTGGTCGCAGGTTCGAAT |
Downstream region at tRNA end position |
ttttctccac |
Secondary structure (Cloverleaf model) | >WENV170012888 Lys TTT t ACCA ttttctccac G - C G - C G - C T - A C - G G - C T - A T A T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |