Sequence ID | >WENV170012889 |
Genome ID | ASRP01009335 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 316 |
End posion on genome | 391 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
aaacttatgt |
tRNA gene sequence |
GGGCGATTAGCTCAGTTGGGAGAGCACCTCCCTTACAAGGAGGGGGTCACTGGTTCGAGC |
Downstream region at tRNA end position |
ttttctcctt |
Secondary structure (Cloverleaf model) | >WENV170012889 Val TAC t ACCA ttttctcctt G - C G - C G - C C - G G - C A - T T - A C G T T G G C C A T G A A | | + | | G T C T C G A C T G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |