Sequence ID | >WENV170012890 |
Genome ID | ASRP01010454 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 176 |
End posion on genome | 101 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ataatgtgat |
tRNA gene sequence |
GCGGTACTAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGTCACGAGTTCGAGT |
Downstream region at tRNA end position |
attttgaagt |
Secondary structure (Cloverleaf model) | >WENV170012890 Gly GCC t TCCA attttgaagt G - C C - G G - C G - C T - A A - T C - G T G T T G C T C A T G A A | | | | | G T C T C G A C G A G C G | | | | T T G G A G C T A A GGGTC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |