Sequence ID | >WENV170012893 |
Genome ID | ASRP01011437 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 113 |
End posion on genome | 39 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aaatatatat |
tRNA gene sequence |
TCCTTCGTAGCTCAGCGGTAGAGTAGATGGCTGTTAACCATTTGGTCACTGGTTCGAATC |
Downstream region at tRNA end position |
tatttactgt |
Secondary structure (Cloverleaf model) | >WENV170012893 Asn GTT t GCCA tatttactgt T - A C - G C - G T + G T - A C - G G - C T A T T G A C C A G A A | | | | | G C C T C G A C T G G C G | | | + T T G G A G T T A A TGGTC G + T A - T T - A G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |