Sequence ID | >WENV170012894 |
Genome ID | ASRP01011557 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 73 |
End posion on genome | 1 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ttagccttat |
tRNA gene sequence |
GTACACCAATGTCCCAAGGCAGGCGAGTTTGTCTCCAAAACAAACTGGCTAGGTTCGATT |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170012894 Trp CCA t Gnnn nnnnnnnnnn G + T T - A A - T C - G A - T C - G C - G T T A G A T C C A A C C A | | | | | G A C T G T C T A G G C G | | T T G G C G A C A G G CTGG T - A T - A T - A G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |