Sequence ID | >WENV170012895 |
Genome ID | ASRP01012226 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 3 |
End posion on genome | 78 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
nnnnnnnnac |
tRNA gene sequence |
GCCGGTATAGCTCAGTTGGTAGAGCACCTGATTTGTAATCAGGGGGTCGGGAGTTCAAGT |
Downstream region at tRNA end position |
cttttctttg |
Secondary structure (Cloverleaf model) | >WENV170012895 Thr TGT c ACCA cttttctttg G - C C - G C - G G - C G - C T + G A - T T G T C T C T C A T G A A | + | | | A T C T C G G G G A G C G | | | | T T G G A G C T A A GGGTC C - G C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |