Sequence ID | >WENV170012900 |
Genome ID | ASRP01012737 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 284 |
End posion on genome | 208 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tttcattaat |
tRNA gene sequence |
GCGTCCTTAGCTCAGCTGGATAGAGCAACGCCCTTCTAAGGCGTAGGTCATACGTTCGAA |
Downstream region at tRNA end position |
cttctaataa |
Secondary structure (Cloverleaf model) | >WENV170012900 Arg TCT t ACCA cttctaataa G + T C - G G - C T + G C - G C - G T - A T A T T A T G C A C G A A | | | | | G T C T C G A T A C G C G | | | | T T G G A G C A T A A AGGTC A - T C - G G - C C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |