Sequence ID | >WENV170012902 |
Genome ID | ASRP01014108 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 246 |
End posion on genome | 170 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
gcaacaggct |
tRNA gene sequence |
GGCCCCTTAGCTCAGTTGGATAGAGCAGCTGACTTCTAATCAGCAGGTCGAGGGTTCGAA |
Downstream region at tRNA end position |
atattttcca |
Secondary structure (Cloverleaf model) | >WENV170012902 Arg TCT t GCCA atattttcca G - C G + T C - G C - G C - G C - G T - A T A T C T T C C A T G A A | | + | | G T C T C G G A G G G C G | | | | T T G G A G C A T A A AGGTC G - C C - G T - A G - C A - T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |