Sequence ID | >WENV170012903 |
Genome ID | ASRP01016062 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 350 |
End posion on genome | 275 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tttaattttt |
tRNA gene sequence |
CGGAAACTGGCGCAATTGGTAGCGCACGTGTTTTGGGAACACGGGGTTGTAGGTTCAAGT |
Downstream region at tRNA end position |
tttacaaaaa |
Secondary structure (Cloverleaf model) | >WENV170012903 Pro TGG t ACCA tttacaaaaa C - G G - C G - C A - T A - T A - T C - G T G T C G T C C A T A A G | + | | | A T C G C G G T A G G C G | | | | T T G G C G C T A A GGGTT C - G G - C T - A G - C T - A T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |