Sequence ID | >WENV170012909 |
Genome ID | ASRP01019746 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 302 |
End posion on genome | 227 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tattatgagt |
tRNA gene sequence |
GCTGATATAGCTCAGTCGGTAGAGCGCACCCTTGGTAAGGGTGAGGTCCCCAGTTCAAAT |
Downstream region at tRNA end position |
gctcttaaag |
Secondary structure (Cloverleaf model) | >WENV170012909 Thr GGT t ACCA gctcttaaag G - C C - G T - A G - C A - T T - A A - T T A T G G G T C A T G A A | | | | | A C C T C G C C C A G C G | | | | T T G G A G C T A G AGGTC C - G A - T C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |