Sequence ID | >WENV170012910 |
Genome ID | ASRP01020728 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 243 |
End posion on genome | 168 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ctttcaaaat |
tRNA gene sequence |
GCTTCTTTAGCTCAGTTGGTAGAGCGCTCGACTGTTAATCGAGTTGTCGCAGGTTCAAGT |
Downstream region at tRNA end position |
tttgtttagt |
Secondary structure (Cloverleaf model) | >WENV170012910 Asn GTT t GCCA tttgtttagt G - C C - G T - A T - A C - G T - A T - A T G T C G T C C A T G A A | | | | | A T C T C G G C A G G C G | | | | T T G G A G C T A G TTGTC C - G T - A C - G G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |