Sequence ID | >WENV170012912 |
Genome ID | ASRP01021159 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 94 |
End posion on genome | 20 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
caatgtgtaT |
tRNA gene sequence |
GGGGGTATAGCTCAGTTGGGAGAGCACCTGCCTTGCAAGCAGGGGGTCAAGAGTTCGAAT |
Downstream region at tRNA end position |
gacatgaaac |
Secondary structure (Cloverleaf model) | >WENV170012912 Ala TGC T ATtc gacatgaaac G - C G - C G + T G - C G + T T - A A - T T A T T T C T C A T G A A | | | | | G T C T C G A A G A G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |