Sequence ID | >WENV170012915 |
Genome ID | ASRP01022330 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 185 |
End posion on genome | 260 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
ttaatgagat |
tRNA gene sequence |
GCCCTCTTAGCTCAGTTGGTAGAGCAACTGACTCTTAATCAGTGGGTCGTAGGTTCGAGC |
Downstream region at tRNA end position |
aaagataata |
Secondary structure (Cloverleaf model) | >WENV170012915 Lys CTT t ACCA aaagataata G + T C - G C - G C - G T + G C - G T - A C G T C A T C C A T G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C T A A GGGTC A - T C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |