Sequence ID | >WENV170012931 |
Genome ID | ASRQ01000028 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 27534 |
End posion on genome | 27618 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgtcagacat |
tRNA gene sequence |
GCGGATGTGGCGGAATAGGCAGACGCACAGGATTCAAAATCCTGCGGTGGTGACATCGTG |
Downstream region at tRNA end position |
ctttgagaga |
Secondary structure (Cloverleaf model) | >WENV170012931 Leu CAA t ACtg ctttgagaga G - C C - G G - C G - C A - T T - A G - C T C T C A C C C A T A A G | | | | | G A G G C G G T G G G C G | | | T T G A C G C C A G A CGGTGGTGACATCGT C - G A - T G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |