Sequence ID | >WENV170012938 |
Genome ID | ASRQ01000084 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 69 |
End posion on genome | 145 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ttttaagtgt |
tRNA gene sequence |
GCGGTTGTAGTTTAGTTGGTTAGAATGCCTGCCTGTCACGCAGGATGTCGCGAGTTCGAG |
Downstream region at tRNA end position |
cttttgtctt |
Secondary structure (Cloverleaf model) | >WENV170012938 Asp GTC t GCCA cttttgtctt G - C C - G G - C G - C T - A T - A G - C T G T T G C T C A T G A A + | | | | G T T T T G G C G A G C G + | | + T T G G A A T T T A G ATGTC C - G C - G T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |