Sequence ID | >WENV170012953 |
Genome ID | ASRQ01000211 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1351 |
End posion on genome | 1438 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tctcatttac |
tRNA gene sequence |
GGACAGCTGGCTGAGTGGCCGAAAGCGCGCGCTTGGAAGGCGTGTATAGGGCAACCTATC |
Downstream region at tRNA end position |
tttattcttt |
Secondary structure (Cloverleaf model) | >WENV170012953 Ser GGA c GCCA tttattcttt G - C G - C A - T C - G A - T G - C C - G T A T A T C C C A T G A G | | | | | A G G T C G T A G G G C G | | | T T C A A G C C G A G TATAGGGCAACCTATC C - G G + T C - G G - C C - G T G T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |