Sequence ID | >WENV170012960 |
Genome ID | ASRQ01000302 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 4637 |
End posion on genome | 4561 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tgaattggat |
tRNA gene sequence |
GGGCCTGTAGCTCAACTGGTTAGAGCCGACCGCTCATAACGGTCTGGTTGGGGGTTCAAG |
Downstream region at tRNA end position |
tctcattctc |
Secondary structure (Cloverleaf model) | >WENV170012960 Met CAT t ACCA tctcattctc G + T G - C G - C C - G C - G T + G G - C T G T C T C C C A C A A A | + | | | A T C T C G G G G G G C G | | | | T T G G A G C T T A C TGGTT G - C A - T C - G C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |