Sequence ID | >WENV170012961 |
Genome ID | ASRQ01000316 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 3731 |
End posion on genome | 3658 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
atcacattca |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCAGGAGCTTCCCAAGCTTAAGACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
gctgttttca |
Secondary structure (Cloverleaf model) | >WENV170012961 Gly CCC a TCCA gctgttttca G - C C - G G - C G - C G - C T - A G - C T T T T T C C C A A A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A A AGAC G A G + T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |