Sequence ID | >WENV170012965 |
Genome ID | ASRQ01000325 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 4052 |
End posion on genome | 3976 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
agattggtca |
tRNA gene sequence |
GCGCTGGTAGCTCAGTTGGATAGAGCACCAGACTACGAATCTGGGGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
tttatttcag |
Secondary structure (Cloverleaf model) | >WENV170012965 Arg ACG a GCCA tttatttcag G - C C - G G - C C - G T - A G - C G - C T A T C C T C C A T G A A | | + | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A GGGTC C - G C - G A - T G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |