Sequence ID | >WENV170012966 |
Genome ID | ASRQ01000330 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 2690 |
End posion on genome | 2779 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cgctgacgcc |
tRNA gene sequence |
GGAGAGGTGGCAGAGTGGTTGAATGCACCGGTCTTGAAAACCGGCGTGCGTGCAAGCGTA |
Downstream region at tRNA end position |
tattttcctg |
Secondary structure (Cloverleaf model) | >WENV170012966 Ser TGA c GCCA tattttcctg G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A T G A G | | | | | G G G A C G G T G G G C G | | | T T T A T G C T G A A CGTGCGTGCAAGCGTACC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |