Sequence ID | >WENV170012970 |
Genome ID | ASRQ01000573 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1839 |
End posion on genome | 1915 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tcattggttt |
tRNA gene sequence |
GGCGGAGTAGCTCAGTTGGTTAGAGCAGCGGAATCATAATCCGCGTGTCGGGGGTTCAAG |
Downstream region at tRNA end position |
aatttcccca |
Secondary structure (Cloverleaf model) | >WENV170012970 Met CAT t ACCA aatttcccca G + T G - C C - G G - C G - C A - T G - C T G T C T C C C A T G A A | + | | | A T C T C G G G G G G C G | | | | T T G G A G C T T A A GTGTC G - C C - G G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |