Sequence ID | >WENV170012974 |
Genome ID | ASRQ01000768 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 366 |
End posion on genome | 452 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cacctgagtt |
tRNA gene sequence |
GCCCAGGTGGCGGAACTGGTAGACGCGCTAGCTTCAGGTGCTAGTTTCTGTATGGAAGTG |
Downstream region at tRNA end position |
aaaatccccg |
Secondary structure (Cloverleaf model) | >WENV170012974 Leu CAG t ACCA aaaatccccg G - C C - G C - G C - G A - T G - C G - C T G T T C T C C A C A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A G G TTTCTGTATGGAAGT C - G T - A A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |