Sequence ID | >WENV170012976 |
Genome ID | ASRQ01000927 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 2 |
End posion on genome | 76 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
nnnnnnnnnt |
tRNA gene sequence |
TGGGGTATCGCCAAGTGGTAAGGCAACGGCTTTTGGTGCCGTCATTCGTAGGTTCGAATC |
Downstream region at tRNA end position |
tattcaattc |
Secondary structure (Cloverleaf model) | >WENV170012976 Gln TTG t TCCA tattcaattc T - A G - C G - C G - C G - C T - A A - T T A T C A T C C A G A C | | | | | G T A C C G G T A G G C G | | | T T G A G G C T A A CATTC A - T C - G G - C G - C C - G T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |