Sequence ID | >WENV170012978 |
Genome ID | ASRQ01001112 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1389 |
End posion on genome | 1459 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ctgatcctgc |
tRNA gene sequence |
TGGGGATTAGTTTAATGGTAGAACAGCGGACTCTGACTCCGTCGGTCCTGGTTCGAGTCC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170012978 Gln CTG c Gnnn nnnnnnnnnn T - A G - C G - C G - C G - C A - T T - A T G T G G A C C A A A A | | | | | G T T T T G C C T G G C G + | | | T T G G A A C T A A CGGT G + T C - G G - C G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |