Sequence ID | >WENV170012982 |
Genome ID | ASRQ01001420 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 560 |
End posion on genome | 484 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
acttcaatga |
tRNA gene sequence |
CGCGGGGTGGAGCAGCCCGGTAGCTCGTCAGGCTCATAACCTGAAGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
atcttttccc |
Secondary structure (Cloverleaf model) | >WENV170012982 Met CAT a ACCA atcttttccc C A G - C C - G G - C G - C G - C G - C T A T C G T C C A C G A G | | | | | G C C G A G G C A G G C C | | | | T T G G C T C G T A G AGGTC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |