Sequence ID | >WENV170012983 |
Genome ID | ASRQ01001485 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 736 |
End posion on genome | 660 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
aatgcagagc |
tRNA gene sequence |
GGGTGATTAGCTCAGCTGGTTAGAGCACCTCGTTTACACCGAGGGGGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
tttcatgcct |
Secondary structure (Cloverleaf model) | >WENV170012983 Val TAC c ACCA tttcatgcct G - C G - C G - C T - A G - C A - T T - A T A T C T C T C A C G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C T T A A GGGTC C - G C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |