Sequence ID | >WENV170012987 |
Genome ID | ASRQ01001679 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 140 |
End posion on genome | 216 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ataggtgaga |
tRNA gene sequence |
GGGCCTATAGCTCAGCTGGCTAGAGCGCTCGACTGATAATCGTGAGGTCCCAGGTTCAAG |
Downstream region at tRNA end position |
tgattaaata |
Secondary structure (Cloverleaf model) | >WENV170012987 Ile GAT a ACCA tgattaaata G - C G - C G - C C - G C - G T - A A - T T G T G G T C C A C G A A | | | | | A T C T C G C C A G G C G | | | | T T G G A G C C T A G AGGTC C - G T T C - G G - C A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |