Sequence ID | >WENV170012989 |
Genome ID | ASRQ01001910 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 76 |
End posion on genome | 1 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ccatcgctaa |
tRNA gene sequence |
GCGCCCTTCGTCTAGCGGTCTAGGACGCCGCCCTTTCACGGCGGAAACACGGGTTCGAGT |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170012989 Glu TTC a GCCA nnnnnnnnnn G + T C - G G - C C - G C - G C - G T - A T G T T G C C C A C G A C | | | | | G G T C T G A C G G G C G + | | | T T T G G A C C T A G AAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |