Sequence ID | >WENV170012992 |
Genome ID | ASRQ01003089 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 421 |
End posion on genome | 505 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cgccaaatgt |
tRNA gene sequence |
GCGGGTGTGGTGGAATTGGTAGACACGCCAGATTTAGGTTCTGGTGGCGCGAGCCGTGGG |
Downstream region at tRNA end position |
aatctctccc |
Secondary structure (Cloverleaf model) | >WENV170012992 Leu TAG t ACCA aatctctccc G + T C - G G - C G - C G - C T - A G - C T G T C T C C C A T A A G | + | | | A T G G T G G G G G G C G | | | T T G A C A C T A G G TGGCGCGAGCCGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |