Sequence ID | >WENV170012993 |
Genome ID | ASRQ01003371 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 479 |
End posion on genome | 406 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
nncgcaggaa |
tRNA gene sequence |
GGCTCGATGGCGGAGTGGTGACGCAGCGGATTGCAAATCCGTGTACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
actcttttct |
Secondary structure (Cloverleaf model) | >WENV170012993 Cys GCA a TCCA actcttttct G - C G - C C - G T - A C - G G - C A - T T T T C G G C C A G A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T G A GTAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |