Sequence ID | >WENV170012994 |
Genome ID | ASRQ01003529 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 78 |
End posion on genome | 4 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
atagagtttc |
tRNA gene sequence |
GCGGGTGTAGCTCAGGGGTAGAGCACAACCTTGCCAAGGTTGGGGTCGTGGGTTCGAATC |
Downstream region at tRNA end position |
gttnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170012994 Gly GCC c TCCA gttnnnnnnn G - C C - G G - C G - C G - C T + G G - C T A T T A C C C A G A A + | | | | G G C T C G G T G G G C G | | | | T T G G A G C T A A GGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |