Sequence ID | >WENV170012999 |
Genome ID | ASRQ01003748 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 168 |
End posion on genome | 79 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tcgaatatgc |
tRNA gene sequence |
GGAGAGGTGCCGGAGTGGTCGAACGGGGCGGTCTCGAAAACCGTTGTGCCTTTGCGGGTA |
Downstream region at tRNA end position |
ttttcatttg |
Secondary structure (Cloverleaf model) | >WENV170012999 Ser CGA c GCCA ttttcatttg G - C G - C A - T G - C A - T G - C G - C T A T T T C C C A T G A G + + | | | G G G G C C G G G G G C G | | | T T T A C G G C G A G TGTGCCTTTGCGGGTACC G + T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |